ID: 1119046462_1119046467

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1119046462 1119046467
Species Human (GRCh38) Human (GRCh38)
Location 14:71321629-71321651 14:71321662-71321684
Sequence CCCCTTTGGGGGTCTTGGGGACA GGATGCTCTAACCTGCTTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 189} {0: 1, 1: 0, 2: 1, 3: 3, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!