ID: 1119055105_1119055113

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1119055105 1119055113
Species Human (GRCh38) Human (GRCh38)
Location 14:71411474-71411496 14:71411513-71411535
Sequence CCTTCCCCAGTTGTCTTCTCTCT AGTCTCTACACTGATTTCACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 50, 4: 663} {0: 1, 1: 0, 2: 1, 3: 10, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!