ID: 1119057583_1119057598

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1119057583 1119057598
Species Human (GRCh38) Human (GRCh38)
Location 14:71438837-71438859 14:71438885-71438907
Sequence CCTGCAGCTTACTTGCCTCCCTC TGGTTACTATGGGAATTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 326} {0: 1, 1: 0, 2: 1, 3: 15, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!