ID: 1119068077_1119068086

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1119068077 1119068086
Species Human (GRCh38) Human (GRCh38)
Location 14:71550970-71550992 14:71551012-71551034
Sequence CCCTTTCCTCTCCAGCCACACTG CGCTGTTTGTTCATATCCTAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 13, 3: 109, 4: 694} {0: 1, 1: 0, 2: 1, 3: 4, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!