ID: 1119068163_1119068171

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1119068163 1119068171
Species Human (GRCh38) Human (GRCh38)
Location 14:71551748-71551770 14:71551764-71551786
Sequence CCCTTTCCCCTCCAGCCACACTG CACACTGGCACTCTTTACCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 93, 4: 653} {0: 1, 1: 1, 2: 2, 3: 12, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!