ID: 1119105050_1119105053

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1119105050 1119105053
Species Human (GRCh38) Human (GRCh38)
Location 14:71915848-71915870 14:71915864-71915886
Sequence CCACTTTGACTGGTGTCCTTATA CCTTATAAGCAGAGGAAATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 15, 2: 165, 3: 594, 4: 1287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!