ID: 1119110637_1119110642

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1119110637 1119110642
Species Human (GRCh38) Human (GRCh38)
Location 14:71970762-71970784 14:71970803-71970825
Sequence CCAGCTGGGGGTAAATGGGGAAC GTAGAAGCAACTGAGGGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 93} {0: 1, 1: 0, 2: 2, 3: 27, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!