ID: 1119111872_1119111878

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1119111872 1119111878
Species Human (GRCh38) Human (GRCh38)
Location 14:71982306-71982328 14:71982355-71982377
Sequence CCTCCCTCCTTCTGTTTATTTTT AATATAGAAGACATCATTTACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 358, 4: 3288} {0: 1, 1: 0, 2: 2, 3: 30, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!