ID: 1119114076_1119114084

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1119114076 1119114084
Species Human (GRCh38) Human (GRCh38)
Location 14:72002206-72002228 14:72002251-72002273
Sequence CCTCACTTTCTGCCTATTGAGAG CCAAATGCTGATAAAGAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 220} {0: 1, 1: 0, 2: 2, 3: 47, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!