ID: 1119126176_1119126179

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1119126176 1119126179
Species Human (GRCh38) Human (GRCh38)
Location 14:72129458-72129480 14:72129490-72129512
Sequence CCTGGCTGTGCCAAGTTTCTATG CAAACTACTCCAACACTTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 156} {0: 1, 1: 8, 2: 62, 3: 285, 4: 936}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!