ID: 1119128433_1119128440

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1119128433 1119128440
Species Human (GRCh38) Human (GRCh38)
Location 14:72150034-72150056 14:72150067-72150089
Sequence CCTCCCAAATTCACGTCTACCTG ATGTTACTTTATATGGAAATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 58, 4: 223} {0: 1, 1: 4, 2: 181, 3: 1045, 4: 3218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!