ID: 1119137890_1119137900

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1119137890 1119137900
Species Human (GRCh38) Human (GRCh38)
Location 14:72237716-72237738 14:72237745-72237767
Sequence CCATGCTCAAACCCCCTGCCTGA GCATGCAGGTGAGCAGGTACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 260} {0: 5, 1: 30, 2: 60, 3: 141, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!