ID: 1119140308_1119140316

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1119140308 1119140316
Species Human (GRCh38) Human (GRCh38)
Location 14:72261364-72261386 14:72261377-72261399
Sequence CCCTTCCCCACTACAGGTCATAC CAGGTCATACAAAAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 117} {0: 1, 1: 0, 2: 0, 3: 22, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!