ID: 1119148526_1119148536

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1119148526 1119148536
Species Human (GRCh38) Human (GRCh38)
Location 14:72337490-72337512 14:72337538-72337560
Sequence CCCTCTCTCATTTCTCCTGATGA CCATCCAAACATGAGCAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 464} {0: 1, 1: 0, 2: 1, 3: 17, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!