ID: 1119151332_1119151336

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1119151332 1119151336
Species Human (GRCh38) Human (GRCh38)
Location 14:72362470-72362492 14:72362483-72362505
Sequence CCATAGTCATCTGATGGCTCAAC ATGGCTCAACTGAGGCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 107} {0: 1, 1: 1, 2: 3, 3: 31, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!