ID: 1119153086_1119153088

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1119153086 1119153088
Species Human (GRCh38) Human (GRCh38)
Location 14:72383549-72383571 14:72383593-72383615
Sequence CCATTCTGCTTATTAACAGGCAT GGAGCTGATACCCTCCATTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 173} {0: 1, 1: 0, 2: 1, 3: 9, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!