ID: 1119157348_1119157361

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1119157348 1119157361
Species Human (GRCh38) Human (GRCh38)
Location 14:72423278-72423300 14:72423313-72423335
Sequence CCCATATGTCCCCCCACCCCATG GGCCCTCAGGCTCACGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 215} {0: 1, 1: 0, 2: 0, 3: 14, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!