ID: 1119157775_1119157781

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1119157775 1119157781
Species Human (GRCh38) Human (GRCh38)
Location 14:72427496-72427518 14:72427533-72427555
Sequence CCGACCAACCTCTGCCCAAATTG AGATAAGTGATTATTCTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 46, 4: 257} {0: 1, 1: 0, 2: 1, 3: 15, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!