ID: 1119172513_1119172526

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1119172513 1119172526
Species Human (GRCh38) Human (GRCh38)
Location 14:72545858-72545880 14:72545909-72545931
Sequence CCTTCAGCTTGCCAGTTCTGCAG CTGTGTGTGTGTGTGTCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 209} {0: 1, 1: 17, 2: 229, 3: 2449, 4: 10632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!