ID: 1119181250_1119181267 |
View in Genome Browser |
Spacer: 28 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1119181250 | 1119181267 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 14:72606678-72606700 | 14:72606729-72606751 |
| Sequence | CCCACCAAATTCCGTGTTGAAAT | AGTGGGAAGTGTTTGGGTCGTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 4, 1: 35, 2: 390, 3: 1303, 4: 2964} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||