ID: 1119182782_1119182789

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1119182782 1119182789
Species Human (GRCh38) Human (GRCh38)
Location 14:72615611-72615633 14:72615626-72615648
Sequence CCCACCCACAGGCTCTTCCCTGG TTCCCTGGTTCCAGTCGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 487} {0: 1, 1: 0, 2: 0, 3: 3, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!