ID: 1119183677_1119183683

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1119183677 1119183683
Species Human (GRCh38) Human (GRCh38)
Location 14:72621243-72621265 14:72621296-72621318
Sequence CCCTTGGGGGCAAAATCTTGTTT CCTTGCATACAGGAGCTGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 181} {0: 1, 1: 0, 2: 0, 3: 17, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!