ID: 1119183678_1119183683

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1119183678 1119183683
Species Human (GRCh38) Human (GRCh38)
Location 14:72621244-72621266 14:72621296-72621318
Sequence CCTTGGGGGCAAAATCTTGTTTT CCTTGCATACAGGAGCTGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 223} {0: 1, 1: 0, 2: 0, 3: 17, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!