ID: 1119184355_1119184361

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1119184355 1119184361
Species Human (GRCh38) Human (GRCh38)
Location 14:72629492-72629514 14:72629507-72629529
Sequence CCAGGTTGCTCCCAAGTGCCAGG GTGCCAGGGTAACAGGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 227} {0: 1, 1: 1, 2: 1, 3: 8, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!