ID: 1119194746_1119194757

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1119194746 1119194757
Species Human (GRCh38) Human (GRCh38)
Location 14:72709098-72709120 14:72709133-72709155
Sequence CCCTAGACCCTATTCTGATACTA GTGGCAACACACTCCCCGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 80} {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!