ID: 1119214221_1119214225

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1119214221 1119214225
Species Human (GRCh38) Human (GRCh38)
Location 14:72856284-72856306 14:72856329-72856351
Sequence CCTTTTCTCCTCTAAAACAGGAG TCATCCATCTTGCAGCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 332} {0: 1, 1: 0, 2: 2, 3: 17, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!