ID: 1119223763_1119223782

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1119223763 1119223782
Species Human (GRCh38) Human (GRCh38)
Location 14:72928871-72928893 14:72928922-72928944
Sequence CCCCAAACTGGAGAGCCCCAAGG TTTTGGCCCCGTGCTAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 316} {0: 1, 1: 0, 2: 1, 3: 2, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!