ID: 1119257229_1119257238

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1119257229 1119257238
Species Human (GRCh38) Human (GRCh38)
Location 14:73208932-73208954 14:73208959-73208981
Sequence CCCTCCTCAGTCTCCCTCCCATG TCAGCACCCAAAGTCCAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 27, 3: 176, 4: 1151} {0: 12, 1: 31, 2: 87, 3: 140, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!