ID: 1119262439_1119262460

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1119262439 1119262460
Species Human (GRCh38) Human (GRCh38)
Location 14:73245726-73245748 14:73245772-73245794
Sequence CCAGCTTCCCCAGCCCCTCCTGG GCTCCTGGCCGCGGGCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 12, 3: 140, 4: 1153} {0: 1, 1: 0, 2: 2, 3: 24, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!