ID: 1119296498_1119296508

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1119296498 1119296508
Species Human (GRCh38) Human (GRCh38)
Location 14:73537582-73537604 14:73537619-73537641
Sequence CCGACACCCTTGGCGAGCTGGAC CGCGCTGGGCGGCAGCTTCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 87} {0: 3, 1: 1, 2: 0, 3: 13, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!