|
Left Crispr |
Right Crispr |
| Crispr ID |
1119316864 |
1119316867 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:73703820-73703842
|
14:73703847-73703869
|
| Sequence |
CCGTCCTCCTGCTCTTTGCTCTG |
AAAGATCCACCTACGACCTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 10, 1: 34, 2: 50, 3: 113, 4: 938} |
{0: 290, 1: 334, 2: 165, 3: 83, 4: 108} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|