ID: 1119324295_1119324308

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1119324295 1119324308
Species Human (GRCh38) Human (GRCh38)
Location 14:73750499-73750521 14:73750539-73750561
Sequence CCTGGAAGCCAAGAGAGCCCAAA GGACTGCAGAGGTGAGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 274} {0: 1, 1: 2, 2: 2, 3: 44, 4: 501}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!