ID: 1119325727_1119325736

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1119325727 1119325736
Species Human (GRCh38) Human (GRCh38)
Location 14:73758867-73758889 14:73758890-73758912
Sequence CCTAGACCTTTACCCAGAGGCCT TGGGGGCAACCTGACACACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 172} {0: 1, 1: 0, 2: 1, 3: 10, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!