ID: 1119325956_1119325974

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1119325956 1119325974
Species Human (GRCh38) Human (GRCh38)
Location 14:73759706-73759728 14:73759755-73759777
Sequence CCCTCGCCGGCCCCGCCGCGTGC CCACTTACCCAGCTCTTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 375} {0: 1, 1: 1, 2: 2, 3: 13, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!