ID: 1119343272_1119343276

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1119343272 1119343276
Species Human (GRCh38) Human (GRCh38)
Location 14:73899599-73899621 14:73899623-73899645
Sequence CCAATGAGAAGCAGCGTAGGGAG GGAGCTTGCAATTTAGAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103} {0: 1, 1: 0, 2: 0, 3: 15, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!