|
Left Crispr |
Right Crispr |
| Crispr ID |
1119356611 |
1119356616 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:74012361-74012383
|
14:74012387-74012409
|
| Sequence |
CCTCCTAAAGTGCTGGGATTATA |
ATGAGCCACCGGTCCCAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 872, 1: 35777, 2: 334417, 3: 257751, 4: 146024} |
{0: 1, 1: 0, 2: 106, 3: 1153, 4: 5091} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|