ID: 1119362944_1119362953

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1119362944 1119362953
Species Human (GRCh38) Human (GRCh38)
Location 14:74067071-74067093 14:74067100-74067122
Sequence CCAGGTGGTGGCCCGCACCTGTG GCTGCTCAGGAGGCTGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 89, 4: 370} {0: 2224, 1: 84335, 2: 183383, 3: 212836, 4: 150147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!