ID: 1119362944_1119362954

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1119362944 1119362954
Species Human (GRCh38) Human (GRCh38)
Location 14:74067071-74067093 14:74067103-74067125
Sequence CCAGGTGGTGGCCCGCACCTGTG GCTCAGGAGGCTGAGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 89, 4: 370} {0: 231, 1: 5686, 2: 13820, 3: 33724, 4: 78204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!