ID: 1119375839_1119375841

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1119375839 1119375841
Species Human (GRCh38) Human (GRCh38)
Location 14:74192087-74192109 14:74192123-74192145
Sequence CCATTTATCTTGCATTGGAAGAT AATAGGTCTTTTGTCACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 84, 4: 437} {0: 1, 1: 0, 2: 1, 3: 5, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!