ID: 1119400610_1119400620

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1119400610 1119400620
Species Human (GRCh38) Human (GRCh38)
Location 14:74359832-74359854 14:74359876-74359898
Sequence CCTCGGCCAGCCTGGCTGTCAGT GAGCGTCTTCTCGGAGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 21, 4: 334} {0: 1, 1: 0, 2: 1, 3: 18, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!