|
Left Crispr |
Right Crispr |
| Crispr ID |
1119407716 |
1119407722 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:74409229-74409251
|
14:74409277-74409299
|
| Sequence |
CCACCACGCCAGGCTAATTTTCA |
TCTCCTTGTGTTGCTCATGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 253, 2: 5437, 3: 82219, 4: 227188} |
{0: 1, 1: 4, 2: 223, 3: 3035, 4: 22881} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|