ID: 1119420803_1119420809

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1119420803 1119420809
Species Human (GRCh38) Human (GRCh38)
Location 14:74506667-74506689 14:74506696-74506718
Sequence CCAGACCTTGGGTAGCCCACAGG ACCCACACAGTCCCAGCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 204} {0: 1, 1: 0, 2: 4, 3: 28, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!