ID: 1119421304_1119421308

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1119421304 1119421308
Species Human (GRCh38) Human (GRCh38)
Location 14:74509412-74509434 14:74509437-74509459
Sequence CCAGGCAATGCAGGAACCTCACC GGCTTCCCTCTCTGAGCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 135} {0: 1, 1: 0, 2: 2, 3: 48, 4: 451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!