ID: 1119430569_1119430576

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1119430569 1119430576
Species Human (GRCh38) Human (GRCh38)
Location 14:74565649-74565671 14:74565681-74565703
Sequence CCAGGAGGCAGAACTTGGGAGAG GCTGTAGACACAGTTGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 554} {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!