ID: 1119445574_1119445579

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1119445574 1119445579
Species Human (GRCh38) Human (GRCh38)
Location 14:74660735-74660757 14:74660776-74660798
Sequence CCGCCAACAAACTTCTTAGGAGC TCCCAAACCCCTTGTGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87} {0: 1, 1: 0, 2: 5, 3: 37, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!