ID: 1119472641_1119472654

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1119472641 1119472654
Species Human (GRCh38) Human (GRCh38)
Location 14:74909366-74909388 14:74909411-74909433
Sequence CCCACAGGGTACTCCCAGGAGCC GGCCCCCTGAAAGGCTGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120} {0: 1, 1: 0, 2: 0, 3: 23, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!