ID: 1119554466_1119554477

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1119554466 1119554477
Species Human (GRCh38) Human (GRCh38)
Location 14:75542618-75542640 14:75542667-75542689
Sequence CCCAGATCAGCCACTTCCTCCTG TAAGTGTCAGGCTGGCTGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 338} {0: 1, 1: 0, 2: 1, 3: 19, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!