ID: 1119557722_1119557727

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1119557722 1119557727
Species Human (GRCh38) Human (GRCh38)
Location 14:75566440-75566462 14:75566488-75566510
Sequence CCAGCTTGTGTGCCACCAGGACT AAGTACTTTTGTGTTTGTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!