ID: 1119601709_1119601713

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1119601709 1119601713
Species Human (GRCh38) Human (GRCh38)
Location 14:75981107-75981129 14:75981134-75981156
Sequence CCTTGTAGCGCTGGGATTCTTGT GTGTCTAAACAGGTTTTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79} {0: 1, 1: 0, 2: 1, 3: 17, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!