ID: 1119640121_1119640129

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1119640121 1119640129
Species Human (GRCh38) Human (GRCh38)
Location 14:76308602-76308624 14:76308628-76308650
Sequence CCCCCAGGCCAGCTTCAAGGGGG ACACCAAGGCTTGGTTCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 167} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!